Molekularne podstawy różnych postaci metachromatycznej leukodystrofii ad

Sekwencje oligonukleotydów zastosowane do amplifikacji fragmentów pokazanych na Figurze były następujące: dla fragmentu A, sekwencja 5 TCGAATTCTGCTGGAGCCAAGTAGCCCT3 oligonukleotydu i sekwencja oligonukleotydowa 3 GAAAGACTGGAGTTAGCACT3 ; dla fragmentu C, sekwencja oligonukleotydu 4 5 CGGAATTCTTGATGGGGAACTGAGTGAC3 i sekwencja oligonukleotydu 5 5 GCGAAGCTTCCTCATTGGTACCACAGG3 ; a dla fragmentu D sekwencja oligonukleotydu była taka sama jak sekwencja A i sekwencja oligonukleotydu 2 5 GAGGATCCCAGTGCAGGAGGCACTGAGG3 . Fragmenty subklonowano do M13mp18 i M13mp19 i sekwencjonowano zgodnie ze standardowymi technikami.7 Hybrydyzacja oligonukleotydów specyficznych dla allelu
Genotyp pacjentów określono przez hybrydyzację oligonukleotydów specyficznych dla allelu. Fragmenty A i C (Fig. 1) amplifikowano, przeniesiono na filtry nylonowe i hybrydyzowano z oligonukleotydami znakowanymi końcowo z [32P] ATP i kinazą T4. Stosowane metody opisano gdzie indziej.6 Sekwencja oligonukleotydów stosowanych do wykrywania mutacji alleli I w miejscu splicingowym była 5 TGGTTCCTACCTGGTCGT3 (57 ° C) dla prawidłowego allelu i 5 TGGTTCCTATCTGGTCGT3 (57 ° C) dla zmutowany allel. Sekwencja oligonukleotydów stosowanych do wykrywania wymiany leucyny na prolinę w pozycji 426 w allelu A to 5 CATAGAGCAGCGGGGGCT3 (59 ° C) dla prawidłowego allelu i 5 CATAGAGCAGCAGGGGCT3 (59 ° C) dla zmutowanego allelu. (Wartości w nawiasach wskazują temperatury, w których filtry zostały przemyte w celu uzyskania sygnału specyficznego dla allelu).
Transfekcja i analiza Western Blot
Transfekcję komplementarnego DNA arylosulfatazy A (cDNA) w komórkach nerek chomika przeprowadzono tak, jak to opisano gdzie indziej.8 Przeprowadzono analizę Western blot i traktowanie hodowanych ludzkich fibroblastów karbobenzo-fenylo-diazometyloketonem, jak opisano w innym miejscu. 9, 10
Wyniki
Identyfikacja mutacji w genie Arylosulfatazy A.
Gen arylosulfatazy A został scharakteryzowany ostatnio. Można go amplifikować w dwóch zachodzących na siebie fragmentach (ryc. 1). Aby zidentyfikować defekty molekularne w metachromatycznej leukodystrofii, zamplifikowaliśmy gen arylosulfatazy A u pacjenta z młodzieńczym początkiem choroby. Zamplifikowane fragmenty subklonowano do M13mp18 i M13mp19 i sekwencjonowano w obu kierunkach.
U tego pacjenta zidentyfikowano dwa różne metachromatyczne allele leukodystroficzne. Jeden allel – oznaczony allel I – różnił się w trzech pozycjach od opublikowanej sekwencji genu dla arylosulfatazy A: transwersja G . T zmieniająca tryptofan w pozycji 193 na cysteinę, transkrypcja C . G zmieniająca treoninę w pozycji 391 na serynę i G . Przejście niszczące miejsce donorowe składania eksonu 2 przez zmianę sekwencji konsensusowej klasycznej egzon-intron AG gt … na AG w …. Wymiana seryny na treoninę w pozycji 391 jest polimorfizmem, który znaleziono w DNA z czterech z ośmiu zdrowych kontroli (dane niepublikowane).
Wymiana cysteiny na tryptofan w pozycji 193 została wprowadzona do cDNA 12 arylosulfatazy przez ukierunkowaną mutagenezę, a zmutowany cDNA przejściowo ulegał ekspresji w komórkach nerki niemowlęcia-chomika po transfekcji.
[przypisy: dzisiaj jestem blondynką, vivamed tarnów, gumtree poznań zwierzaki ]